Mastering 16

To produce a DNA fragment that contains the whole gene and has two sticky ends, where must the enzyme’s restriction sites be located?

outside the gene on both sides, but not inside the gene

Which enzyme(s) will produce a DNA fragment that contains the entire vgp gene (shown in red) and has "sticky ends"?
Select all that apply.

HindIII BamHI (Cloning the vgp gene requires an enzyme that has restriction sites on both sides of that gene but not within the gene. Two enzymes, HindIII and BamHI, satisfy that requirement, while also producing DNA fragments that have sticky ends. Sticky ends make it possible for the fragments to combine with the DNA of a cloning vector, such as a plasmid.)

For the first time, the U.S. Food and Drug Adminis

food from a genetically altered animal

The fish in the video have been genetically engineered to _____.

grow faster

The modified salmon were created by _____.

adding genetic material from a Pacific salmon and an eel-like fish

According to the producers of the genetically modified salmon, the meat _____.

looks and tastes the same as unmodified salmon

What concerns do some consumer groups have about genetically modified fish?

They want food from genetically modified fish to be clearly labeled as genetically modified. They want to prevent genetically modified fish from breeding with wild fish. They want more studies on the health effects that genetically modified fish may have on people who eat it.

How does the company raising these fish claim to prevent the genetically modified fish from breeding with wild fish?

The genetically modified fish are sterile.

Folk singer Woody Guthrie died of Huntington’s disease, an autosomal dominant disorder. Which statement below must be true?

It is very likely that at least one of Woody Guthrie’s parents also have had the allele for Huntington’s disease. (Unless the disease is caused by a new mutation, which is quite rare, individuals with a dominant condition must have inherited the dominant allele from one of their parents. As it happens, Guthrie’s mother also died of Huntington’s disease.)

Various procedures can be used to detect genetic disorders before birth. Among the tests discussed in this chapter, which is the least invasive (list first), and which two allow the chromosomes of the fetus to be examined?

ultrasound imaging … chorionic villus sampling … amniocentesis (Both CVS and amniocentesis involve the preparation of a karyotype using fetal cells.)

In order to insert a human gene into a plasmid, both must _____

be cut by the same restriction enzyme (Doing so will result in the formation of complementary sticky ends.)

What enzyme forms covalent bonds between restriction fragments?

DNA ligase (DNA ligase catalyzes the formation of covalent bonds between restriction fragments.)

The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.

sticky ends

The sticky end of the DNA restriction fragment shown here will pair with a DNA restriction fragment with the sticky end _____.
The figure shows the part of the DNA. One strand from left to right reads T G C A G A A T T C. The second strand, which is complementary to the first, reads backwards C T T A A G, excluding the first four nucleotides.

-ACGT

What information can not be obtained from the sequence of a gene?

Whether the gene is methylated.

What is the polymerase chain reaction (PCR)?

A method to amplify a fragment of DNA (PCR is an in vitro DNA synthesis reaction that produces many copies of a single DNA fragment.)

True or false? Comparison of the sequences of the same gene across species can give some insight into the existence of a common ancestor with that gene.

True (DNA sequence comparisons are a powerful tool by which to estimate how closely related different species are along the evolutionary timeline.)

True or false? The Taq enzyme is a type of DNA polymerase that allows researchers to separate the DNA strands during the annealing step of the PCR cycle without destroying the polymerase.

False (Taq polymerase is derived from a species of bacteria living in hot springs, which makes it stable at the high temperature required for the denaturation step of PCR.)

How many DNA molecules would there be after four rounds of PCR if the initial reaction mixture contained two molecules?

32

During which step in the PCR cycle are nucleotides used?

Extension. (Nucleotides are used to synthesize the complementary strand to the DNA template during the extension step.)

During which step in the PCR cycle do primers form bonds with a single-stranded template?

Annealing. (Primers form hydrogen bonds with the single-stranded DNA template during the annealing step.)

In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter A?
The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.

6,557

In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter B?
The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.

between 6,557 and 4,361 base pairs

DNA fragment B consists of _____ base pairs.
The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.

1,405

Which of these DNA molecules is the shortest?

E (The shorter the DNA molecule, the farther it moves.)

In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel.

negative … positive (An electrical current is generated across the gel, and DNA molecules migrate from the negative end toward the positive end.)

This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 1?

B (A visual comparison of the gel electrophoresis results should reveal that Suspect 1 has a DNA fragment that matches victim DNA fragment B.)

This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 2?

C (A visual comparison of the gel electrophoresis results should reveal that Suspect 2 has a DNA fragment that matches victim DNA fragment C.)

Why is Suspect 1 considered more likely to have committed the crime than Suspect 2?

The crime scene sample contains DNA fragments from both the victim and Suspect 1. (Such a good match between crime scene DNA fragments and Suspect 1 DNA fragments strongly suggest that Suspect 1 committed the crime.)

Which of the following tools of recombinant DNA technology is incorrectly paired with its use?

reverse transcriptase – production of cDNA from mRNA

DNA ligase – enzyme that cuts DNA, creating the sticky ends of restriction fragments

electrophoresis – separation of DNA fragments
restriction enzyme – production of RFLPs

DNA polymerase – used in a polymerase chain reaction to amplify sections of DNA

DNA ligase – enzyme that cuts DNA, creating the sticky ends of restriction fragments

Which of the following would not be true of cDNA produced using human brain tissue as the starting material?

It could be used to create a complete genomic library.

A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). The researcher would like to compare a specific region of the DNA from the sample with DNA from living birds. Which of the following would be most useful for increasing the amount of dodo DNA available for testing?

polymerase chain reaction (PCR)

Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problem of

post-transcriptional processing.

DNA technology has many medical applications. Which of the following is not done routinely at present?

genetic testing for carriers of harmful alleles

prenatal identification of genetic disease genes

production of hormones for treating diabetes and dwarfism

introduction of genetically engineered genes into human gametes

production of viral proteins for vaccines

introduction of genetically engineered genes into human gametes

In recombinant DNA methods, the term vector can refer to

a plasmid used to transfer DNA into a living cell.

Which of the following is an example of "recombinant DNA technology?"

introducing a human gene into a bacterial plasmid (Recombinant DNA technology involves combining DNA from different sources into a single molecule, such as inserting a gene from one species into a plasmid from another.)

In recombinant DNA experiments, _____ is used to cut pieces of DNA and _____ joins the resulting fragments to form recombinant DNA.

a restriction enzyme … DNA ligase (Restriction enzymes cut DNA molecules at specific points; in most cases, the restriction fragments have sticky ends that can base-pair with complementary sticky ends. The joined segments are then covalently fused by DNA ligase.)

Archaeologists unearthed a human skull with a small dried fragment of the scalp still attached. They extracted a tiny amount of DNA from the scalp tissue. How could they obtain sufficient DNA for an analysis of the ancient human’s genes? (Concept 20.1)

Use the polymerase chain reaction (PCR is a method of DNA amplification.)

cDNA is synthesized from _____ using an enzyme called _________

mRNA … reverse transcriptase (Reverse transcriptase is a viral enzyme that can synthesize DNA from an RNA template.)

The "ingredients" for PCR and for the dideoxy chain-termination method of DNA sequencing are both similar and include __________.

Free nucleotides, DNA polymerase, DNA primers (If DNA polymerase encounters a DNA template strand with a primer attached to it, and free nucleotides are available, DNA synthesis will proceed.)

Gel electrophoresis separates DNA fragments on the basis of ________.

length (As the DNA fragments move through the gel, longer fragments are impeded more than shorter fragments, producing characteristic banded patterns in the gel.)

If cells from a carrot are removed and placed in a culture medium, they can develop into a normal adult plant. This demonstrates that carrot cells _____.

retain all the genes that were in the zygote that developed into the original plant (Furthermore, the carrot cells are totipotent.)

Which of the following is true of stem cells?

They can be found in both embryonic and adult tissues. Their use is highly controversial. They can differentiate to produce many different kinds of specialized cells. They can reproduce indefinitely in culture.

You are a member of the jury for a murder case. The prosecution has presented DNA evidence linking the defendant to the crime scene. The defense claims that DNA evidence using STR analysis with 13 markers is not sufficient to reliably distinguish between people. What do you think? (Concept 20.4)

The prosecution is right. STR analysis with 13 markers gives a 1 in 10 billion or greater chance that two people will have the same pattern. This person was at the crime scene. (Given the current population of the Earth, STR analysis with 13 markers should be sufficient to distinguish between any two people (excluding identical twins, of course) on the planet.)

What is the most commonly used vector for introducing transgenes into plants?

The Ti plasmid (The Ti plasmid comes from Agrobacterium tumefaciens, and it is effective at integrating with the host cell’s DNA.)

DNA fragment A consists of _____ base pairs.
The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.

1,268

Which of these genes are located on the q arm of chromosome 17?
The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.

gastrin and GH1 (The q arm is the long arm of a chromosome.)

The RP13 gene of chromosome 17 codes for a protein _____.

involved in eye development (The RP13 gene codes for a protein that plays a role in eye development.)

The gene that codes for gastrin is located on the _____ of chromosome 17.
The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.

q arm (The gene that codes for gastrin is located on the long arm of chromosome 17.)

The TP53 gene of chromosome 17 codes for a protein _____.

involved in the regulation of the cell cycle

Which of these genes codes for a protein that plays a role in growth?

GH1 ("GH" stands for growth hormone.)

Which of these genes codes for a protein that plays a role in white blood cell function?

MPO (This gene codes for a protein that plays a role in white blood cell function)

What are the steps in the shotgun approach to whole-genome sequencing?

1. Multiple copies of the same chromosome are prepared 2. Chromosome copies are broken into 1-kb fragments 3. 1-kb fragments are cloned into plasmids 4. The plasmids are sequenced 5. A computer combines the fragmented sequences

In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
Sequences of DNA fragments
GATGAC
CGATGCG
GGCGTCAG
GACATGGC
TCAGTCGA

GATGACATGGCGTCAGTCGATGCG

Bioinformatics includes all of the following except:

analyzing protein interactions in a species.

use of mathematical tools to make sense of biological systems.

development of computer-based tools for genome analysis.

using molecular biology to provide biological information to a system so that it gets expressed.

using computer programs to align DNA sequences.

using molecular biology to provide biological information to a system so that it gets expressed.

Which of the following has the largest genome and the fewest genes per million base pairs?

Saccharomyces cerevisiae (yeast)

Haemophilus influenzae (bacterium)

Arabidopsis thaliana (plant)

Homo sapiens (human)

Drosophila melanogaster (fruit fly)

Homo sapiens (human)

One of the characteristics of retrotransposons is that

they code for an enzyme that synthesizes DNA using an RNA template.

Multigene families are

identical or similar genes that have evolved by gene duplication.

Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this phenomenon?

exon shuffling

Homeotic genes

encode transcription factors that control the expression of genes responsible for specific anatomical structures

Although quite different in structure, plants and animals share some basic similarities in their development, such as

a cascade of transcription factors that regulate gene expression on a finer and finer scale.

The main goal of the Human Genome Project (HGP) was to ________.

map all the human genes and determine the nucleotide sequence of the entire human genome

BLAST is a computational tool used by genome biologists to_________.

compare a given DNA or protein sequence to all other DNA or protein sequences in a database

Which of the following statements about genome sizes is true?

The human genome is the largest and most complex.

Large animals have larger genomes than plants

Most eukaryotes have larger genomes than most prokaryotes.

Species within a phylogenetic group such as flowering plants or insects have similar genome sizes

All of the above statements are true

Most eukaryotes have larger genomes than most prokaryotes. (The only exceptions may be intracellular parasites whose genomes have undergone reduction because they are dependent on their hosts for many functions.)

The number of genes ________.

correlates well with the size of the genome in prokaryotes (Prokaryotic genomes are compact, so the size of the genome accurately reflects the number of genes.)

What type of non-coding DNA comprises the largest portion of multicellular eukaryotic genomes?

Transposons

Retrotransposons differ from other transposons in that ________.

retrotransposons move via an RNA transcript, whereas other transposons do not (Retrotransposons are transcribed into RNA, which is then converted back into DNA by reverse transcriptase.)

Gene duplication has played a critical role in evolution because it ________.

produces redundant copies of existing genes, which are then free to mutate and adopt new functions (The prevalence of multigene families attests to the importance of gene duplication.)

By what mechanism might transposons contribute to gene duplication?

Transposons may promote unequal crossing over during meiosis. (Illegitimate recombination between transposon sequences at different loci leads to chromosome rearrangements and gene deletions and duplications.)

A goal of comparative genomic studies is_________.

to identify genes that are important for evolution of a particular species to identify homologues in model organisms for genes involved in human disease to study genetic variation within a species or a population to study how genomes evolve

What are Hox genes?

Hox genes encode transcription factors with a DNA-binding domain called a homeo box, and regulate development of the vertebrate body plan (Hox genes and their functions have been highly conserved throughout the animal kingdom.)

The _________________________ of a nucleotide, represented here as a yellow ball, contains a negative charge.

phosphate group

_____________ is a method for amplifying DNA.

PCR

DNA normally moves ______________ through a gel due to the attraction of opposite charges.

down

cDNA is synthesized from what molecule using an enzyme known as what?

mRNA … reverse transcriptase (Reverse transcriptase is a viral enzyme that can synthesize DNA from an RNA template.)

Which "ingredients" for PCR and for the dideoxy chain-termination method of DNA sequencing are the same?

free nucleotides, DNA polymerase, DNA primers (If DNA polymerase encounters a DNA template strand with a primer attached to it, and free nucleotides are available, DNA synthesis will proceed.)

What defect causes pituitary dwarfism?

Lack of growth hormone

What is genetic cloning?

A method to produce many copies of a gene

True or false? The use of growth hormone isolated from cadavers was banned mainly because there were not enough cadavers to supply the hormone.

False (The use of growth hormone isolated from cadavers was banned mainly because the isolated hormone was potentially contaminated with prion proteins.)

Which of the following statements best describes the function of reverse transcriptase?

It makes complementary DNA (cDNA) from mRNA.

Which of the following steps would be performed last when screening a cDNA library?

Match the region of radioactivity on the filter with the corresponding plate

How can large quantities of protein be produced from a bacterial colony containing the gene of interest?

Put a cDNA encoding the protein into a plasmid with a bacterial promoter sequence.

True or false? The term "sticky ends" refers to the overhanging ends on DNA that are generated by restriction enzymes, which can base pair with any DNA molecules that contain complementary sticky ends.

True (Restriction enzymes cut DNA and generate "sticky ends," which can then base pair with DNA molecules that contain the same sticky ends.)

Gel electrophoresis separates DNA fragments on the basis of what characteristic?

length

Plants are more readily manipulated by genetic engineering than are animals because

a somatic plant cell can often give rise to a complete plant.

BLAST is a computational tool used by genome biologists to _____.

compare a given DNA or protein sequence to all other DNA or protein sequences in a database (BLAST is the key tool used to compare newly sequenced DNA and proteins to previously sequenced DNA and proteins.)

…

…