Exam 3 Quiz Questions

Which process produces oxygen?
a) cellular respiration
b) photosynthesis

Photosynthesis

Which set of reactions uses H2O and produces O2?
a) light independent reactions
b) light dependent reactions

Light dependent reactions

What is the importance of the light-independent reactions in terms of carbon flow in the biosphere?
a) The light-independent reactions turn glucose, a sugar, into CO2 gas.
b) The light-independent reactions use CO2 to make ATP.
c) The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars.
d) The light-independent reactions turn sugar into ATP for energy.

c) The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars.

True or false? The light-dependent reactions of photosynthesis use water and produce oxygen.

True

Which of the following molecules is the primary product of photosystem I?
a) Carbon dioxide
b) Oxygen
c) NADPH
d) ATP

c) NADPH

What is the biological significance of the light-independent reactions of photosynthesis?
a) They generate ATP and NADPH.
b) They make oxygen.
c) They convert ATP to sugar.
d) They convert carbon dioxide to sugar.

d) they convert carbon dioxide to sugar

Which of the following statements best describes the relationship between the light-dependent and light-independent reactions of photosynthesis?
a) The light-independent reactions release energy, and the light-dependent reactions require energy.
b) The light-dependent reactions produce carbon dioxide, which is then used by the light-independent reactions.
c) The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.
d) The light-dependent reactions pass electrons through an electron transport chain to the light-independent reactions.

c) The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.

Which of the following reactions ensures that the Calvin cycle can make a continuous supply of glucose?
a) Production of 3-phosphoglycerate
b) Regeneration of RuBP
c) Carbon fixation
d) Production of G3P

b) Regeneration of RuBP

Select the correct molecule that is the main product of the Calvin cycle.
a) NADPH
b) G3P
c) Glucose

b) G3P

What is the basic role of CO2 in photosynthesis?

a) CO2 is taken in by plants as a form of inverse respiration, in which carbon dioxide is "breathed in" and oxygen is "breathed out."
b) CO2 is fixed or incorporated into organic molecules.
c) CO2 is a source of electrons in the formation of organic molecules.

b) CO2 is fixed or incorporated into organic molecules.

What is the basic function of the light reactions of photosynthesis?

The basic function of the light reactions of photosynthesis is the conversion of solar energy to chemical energy.

Which of these is a difference between a DNA and an RNA molecule?

a) DNA contains five-carbon sugars, whereas RNA contains six-carbon sugars.
b) DNA is double-stranded, whereas RNA is single-stranded.
c) DNA is a polymer composed of nucleotides, whereas RNA is a polymer composed of nucleic acids.
d) DNA contains nitrogenous bases, whereas RNA contains phosphate groups.
e) DNA contains uracil, whereas RNA contains thymine.

b) DNA is double-stranded, whereas RNA is single-stranded

What are pyrimidines?

Single ring structures

In a nucleotide, the nitrogenous base is attached to the sugar’s _____ carbon and the phosphate group is attached to the sugar’s _____ carbon.

c) 1′ … 5′

Nucleic acids are assembled in the _____ direction.

5′ to 3′

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.

Thymine…cytosine

After DNA replication is completed, _____.

each new DNA double helix consists of one old DNA strand and one new DNA strand

The first step in the replication of DNA is catalyzed by _____.

helicase

The action of helicase creates _____.

replication forks and replication bubbles

Why is the new DNA strand complementary to the 3′ to 5′ strands assembled in short segments?

DNA polymerase can assemble DNA only in the 5′ to 3′ direction

The synthesis of a new strand begins with the synthesis of a(n) _____.

RNA primer complementary to a preexisting DNA strand

An old DNA strand is used as a _____ for the assembly of a new DNA strand.

template

What catalyzes DNA synthesis?

DNA polymerase

Which of the following statements about DNA synthesis is true?
a) Primers are short sequences that allow the initiation of DNA synthesis.
b) As DNA polymerase moves along the template strand, each new nucleotide provides a 5′ hydroxyl group for the next reaction to occur.
c) DNA polymerase adds dNTP monomers in the 3′ to 5′ direction.
d) Nucleotides are added in a random fashion to single-stranded DNA.

a) Primers are short sequences that allow the initiation of DNA synthesis.

Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

Phosphate groups

Which of the following enzymes creates a primer for DNA polymerase?

Primase

Which of the following statements about Okazaki fragments in E. coli is true?

They are formed on the lagging strand of DNA.

Which of the following enzymes is important for relieving the tension in a helix as it unwinds during DNA synthesis?

Topoisomerase

True or false? Single-stranded DNA molecules are said to be antiparallel when they are lined up next to each other but oriented in opposite directions.

True

What is the process called that converts the genetic information stored in DNA to an RNA copy?

Transcription

DNA does not store the information to synthesize which of the following?

Organelles

Transcription begins at a promoter. What is a promoter?

A site in DNA that recruits the RNA Polymerase

Which of the following statements best describes the promoter of a protein-coding gene?

The promoter is a nontranscribed region of a gene.

What determines which base is to be added to an RNA strand during transcription?

Base pairing between the DNA template strand and the RNA nucleotides

Which of the following terms best describes the relationship between the newly synthesized RNA molecule and the DNA template strand?

complementary

What happens to RNA polymerase II after it has completed transcription of a gene?

It is free to bind to another promoter and begin transcription.

Which of the following is/are inputs required for photosynthesis?

Carbon Dioxide

The Calvin Cycle occurs in the

Stroma

Calvin Cycle input

Carbon Dioxide

Non-cyclic photophosphorylation produces (outputs)?

ATP and NADPH+H

A researcher isolates a chloroplast and decreases the pH inside the individual thylakoids. Assuming that there is abundant light energy and CO2 and that there are no other changes to this chloroplast indicate whether the following statement if True or False.

This chloroplast will produce more G3P or glucose than a control chloroplast under the same light and CO2 conditions

False

Based on the previous question indicate whether the following statement is True or False.
The experimental chloroplast will produce more ATP than the control chloroplast.

True

Based on the preceding two questions indicate whether the following statement is True or False.

If the researcher also increased the concentration of NADPH +H+ in the stroma of the experimental chloroplast, but not the control, the experimental chloroplast would produce more G3P or glucose.

True

The backbone of a DNA strand is composed of

Sugar-phosphate bonds

Hydrogen bonds must be broken during the process of DNA replication. These bonds occur between?

nitrogenous bases

During RNA processing a(n) _____ is added to the 5′ end of the RNA

modified guanine nucleotide

During RNA processing a(n) _____ is added to the 3′ end of the RNA.

a long string of adenine nucleotides

Spliceosomes are composed of _____.

snRNPs and other proteins

The RNA segments joined to one another by spliceosomes are _____.

exons

Translation occurs in the _____.

cytoplasm

Which of these correctly illustrates the pairing of DNA and RNA nucleotides?

GTTACG CAAUGC

The direction of synthesis of an RNA transcript is _____.

5′ —> 3

What enzyme catalyzes the attachment of an amino acid to tRNA?

aminoacyl-tRNA synthetase

The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.

CUG

The initiator tRNA attaches at the ribosome’s _____ site.

P

True or false? A codon is a group of three bases that can specify more than one amino acid.

False

Which of the following statements about mutations is false?
a) An addition mutation results in an added base in the DNA sequence.
b) A deletion mutation results in the loss of a base in the DNA sequence.
c) Addition and deletion mutations disrupt the primary structure of proteins.
d) A knock-out mutation results in a total absence of the mutated protein.

d) A knock-out mutation results in a total absence of the mutated protein.

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred?

Deletion

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)?

One addition and one deletion mutation.

If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein?

Two

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred?

An addition mutation and a deletion mutation.

During transcription the mRNA strand is produced anti-parallel to the template DNA strand.

True

During the editing of the initial transcript in a eukaryote what is removed from the sequence?

Intron

In eukaryotes the mRNA must be processed prior to translation. Where does this mRNA processing occur?

Nucleus

A mRNA molecule contains 246 nucleotides, what is the maximum number of amino acids in the polypeptide translated from this mRNA?

82–this is because 3 nucleotides are translated at a time

Translation uses the information in mRNA to guide the synthesis of

proteins

Enzyme complexes that break down protein are called _____.

proteasomes

The nuclear membrane’s role in the regulation of gene expression involves _____.

regulating the transport of mRNA to the cytoplasm

What is the function of a spliceosome?

RNA processing

Protein-phosphorylating enzymes’ role in the regulation of gene expression involves _____.

protein activation

Which statement(s) about inducible operons is/are correct?
a) In an inducible operon, the repressor is synthesized in an active form.
b) In an inducible operon, an inducer inactivates the repressor.
c) Inducible enzymes generally function in synthetic pathways that produce end products from raw materials.

a and b

Which statement(s) about repressible operons is/are correct?
a) In a repressible operon, the repressor is synthesized in an active form.
b) A repressible operon is on unless a corepressor is present.
c) Repressible enzymes generally function in anabolic pathways.

b and c

How are genes coordinately controlled in eukaryotic cells?
a) Coordinately controlled genes in eukaryotic cells are located together on the same chromosome.
b) Coordinately controlled genes in eukaryotic cells share a set of control elements.
c) Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals.

b and c

Nucleoli are present during _____.

interphase

Cytokinesis often, but not always, accompanies _____.

telophase

Chromosomes become visible during _____.

prophase

Centromeres divide and sister chromatids become full-fledged chromosomes during _____.

anaphase

Spindle fibers attach to kinetochores during _____.

prometaphase

LOOK AT ONLINE QUIZ 23

LOOK AT THE ANIMATIONS

During prophase a homologous pair of chromosomes consists of _____.

two chromosomes and four chromatids

During _____ both the contents of the nucleus and the cytoplasm are divided.

the mitotic phase

During _____ the cell grows and replicates both its organelles and its chromosomes.

interphase

A friend of yours goes on a diet and loses 15 pounds in two months. Using your knowledge on cellular energetics how did they get rid of the majority of the weight?

Eliminated through breathing

Where did most of the mass (dry weight) of this tree come from?

–Air –The tree is made of carbon and if it decomposed the carbon would be released, all the light provides is energy

Which of the following best describes the light reactions?

Capture light energy into chemical energy

The Calvin Cycle (dark reactions) occurs in the:

Stroma

inputs and outputs for the Calvin Cycle

Inputs: CO2, ATP, NADH+H Outputs: G3P, ADP, and NADP

Where do we get the energy for the Calvin Cycle from?

Light Reactions

Why have so many types of pigments in a photosystem?

–Greater range of pigments means more absorption of light energy –Antenna pigments are different colors, they all absorb some wavelengths of light and reflect others –you see the light that is reflected

What are the inputs and outputs of non-cyclic photophosphorylation?

Inputs: Light, H2O, ADP, NADP+ Outputs: O2, ATP, NADPH+H

At night which of the following molecules would be expected to increase concentration inside stroma of the chloroplast?

NADP+–nothing to do with this unless there is light therefore it would increase

What is or are the inputs and outputs of Cyclic Photophosphorylation?

Inputs: Light and ADP Outputs: ATP

Three identical plates of radish seeds were placed in different conditions—list the dry mass in increasing order?

Answer: no light, water—light, no water—light, water

What is the structure of genome?

Chromosome and DNA structure

How is the genome copied?

DNA replication

What is the genome used for?

Protein Synthesis

DNA replication involves making _____ from DNA.

DNA

DNA replication occurs in a ___ mechanism.

Semi-conservative

What happens if the wrong base is added?

The backbone would be to narrow or too far apart—DNA polymerase will recognize what happens and pick it out

Where does the energy come from?

-Each nucleotide as it is added, brings its own evergy (triphosphate form= all nucleotides) -comes from cleaving off three phosphates

Why does DNA polymerase only build 5′ to 3′?

Only way that can proofread and bring the energy

Can errors in DNA be repaired after replication?

There is no way to correct error because enzymes don’t know which one is wrong—mutation

What mRNA sequence would this DNA molecule produce?
5′ TATAAATGTCCACTGCGGTC

5′ UAUAAAAUGUCCACUGCGGUC—TATA tells you which one is not the template

Which of the following best describes transcription?

DNA nucleotides are used to sequence RNA nucleotides