|
Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. What would be found only in proteins? |
sulfur |
|
What is found in RNA but not in DNA? |
an additional hydroxyl group |
|
What is true about double-stranded DNA? |
Its strands have a sugar-phosphate backbone. |
|
During replication, the original "parent" DNA _____. |
serves as the template for the creation of two complete sets of DNA |
|
Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. What is the most probable reason for this observation? |
Prokaryotic DNA is much smaller than eukaryotic DNA. |
|
What occurs during DNA replication? |
DNA polymerase elongates the daughter strand, adding new nucleotides to the 3′ end of the molecule. The molecule grows 5′ to 3′ but is therefore read 3′ to 5′. |
|
In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. What is the best explanation for this observation? |
Translation in eukaryotes cannot occur until the RNA leaves the nucleus, whereas in prokaryotes both transcription and translation occur in the cytoplasm. |
|
Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. What nucleotide combinations would encode the minimum number of amino acids needed in this organism? |
two-nucleotide sequence (6^2 combinations) |
|
Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant) |
prematurely stops the translation of the protein |
|
In transcription, _____. |
RNA polymerase links nucleotides to form mRNA. |
|
In eukaryotic cells, a terminator in mRNA synthesis is _____. |
a specific nucleotide sequence in DNA that signals the RNA polymerase to stop |
|
In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____. |
includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns |
|
An anticodon is _____. |
a set of triplet bases that is complementary to a codon triplet on mRNA |
|
If protein production were an assembly line, a ribosome would be _____. |
the worker who puts all of the pieces together |
|
At the start of translation, where does the initiator tRNA bind? |
start codon on the mRNA molecule |
|
During the process of translation, __________ matches an mRNA codon with the proper amino acid. |
transfer RNA |
|
The translation process requires all of the following: _____. |
transfer RNA, ribosomes, AUG codons |
|
The type of mutation represented below is a(n) _____. The big red fly had one eye (wild type) |
insertion |
|
During the lytic cycle, but not the lysogenic cycle, _____. |
whole viruses leave the host cell to infect other cells |
|
Emerging viruses that infect human cells can originate from __________. |
a virus spreading from one host species to humans |
|
The drug AZT was one of the first drugs used to treat HIV. What drug actions would prevent the spread of HIV without harming the host cell? |
inhibition of reverse transcriptase |
|
Radiation is a frequent method of sterilization. It is effective because it causes damage to DNA. However, prions, the agents that cause diseases such as mad cow disease, are unaffected by these treatments because they lack DNA. What is the definition of a prion? Why? |
Prions are proteins that are folded incorrectly. |
|
Bacteria can quickly acquire new genes in a single generation through __________. |
conjugation, transformation, and transduction |
|
Conjugation is a very effective process for spreading antibiotic resistance among diverse bacterial populations such as those found in the mammalian gut. What explains this observation? |
Two different species of bacteria can share DNA, including antibiotic-resistance genes, during conjugation. |
Share This
Flashcard
