Chapter 10- Molecular Biology of the Gene

D) Sulfur

Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins? A) Phosphorus B) Carbon C) Hydrogen D) Sulfur

C) An additional hydroxyl group

Which of the following is found in RNA but not in DNA? A) Two purines and two pyrimidines B) Four different nucleotides C) An additional hydroxyl group D) A covalently bonded backbone

D) Its strands have a sugar-phosphate backbone.

Which of the following is true about double-stranded DNA? A) The two strands are identical. B) Adenine and uracil are present in equal amounts. C) It is shaped like a triple helix. D) Its strands have a sugar-phosphate backbone.

D) Serves as the template for the creation of two complete sets of DNA

During replication, the original "parent" DNA _____. A) Is broken down as a new DNA strand forms B) Is incorporated into the new DNA strand C) Is converted to RNA D) Serves as the template for the creation of two complete sets of DNA

B) Prokaryotic DNA is much smaller than eukaryotic DNA.

Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation? A) Prokaryotic DNA is single-stranded. B) Prokaryotic DNA is much smaller than eukaryotic DNA. C) Prokaryotes do not replicate their DNA. D) Prokaryotic DNA is replicated more slowly than eukaryotic DNA.

B) DNA polymerase elongates the daughter strand, adding new nucleotides to the 3′ end of the molecule. The molecule grows 5′ to 3′ but is therefore read 3′ to 5′.

Which of the following occurs during DNA replication? A) DNA ligase replicates the new strand. DNA polymerase then proofreads the strand and makes any necessary corrections. B) DNA polymerase elongates the daughter strand, adding new nucleotides to the 3′ end of the molecule. The molecule grows 5′ to 3′ but is therefore read 3′ to 5′. C) DNA polymerase replicates the molecule 3′ to 5′ using the original strand as a template to form the new daughter molecule. D) DNA polymerase forms daughter molecules. Ligase then links these molecules together at their 5′ ends, forming the new daughter strand.

D) Translation in eukaryotes cannot occur until the RNA leaves the nucleus, whereas in prokaryotes both transcription and translation occur in the cytoplasm.

In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation? A) Prokaryotic mRNA needs to be extensively processed before it can be translated. B) Ribosomes, which translate the proteins, are found only outside the nucleus in prokaryotes. C) Eukaryotic mRNA can be processed before ribosomes are moved into the nucleus to translate the protein. D) Translation in eukaryotes cannot occur until the RNA leaves the nucleus, whereas in prokaryotes both transcription and translation occur in the cytoplasm.

C) Two-nucleotide sequence (62 combinations)

Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism? A) Four-nucleotide sequence (64 combinations) B) Three-nucleotide sequence (63 combinations) C) Two-nucleotide sequence (62 combinations) D) One-nucleotide sequence (61 combinations)

C) Prematurely stops the translation of the protein

Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant) A) Complete change in amino acid sequence after the mutation B) Single amino acid change C) Prematurely stops the translation of the protein D) No effect

B) RNA polymerase links nucleotides to form mRNA.

In transcription, _____. A) The promoter region acts as an initial binding site for mRNA B) RNA polymerase links nucleotides to form mRNA. C) Both DNA strands are used as the templates D) A polypeptide is formed

C) A specific nucleotide sequence in DNA that signals the RNA polymerase to stop

In eukaryotic cells, a terminator in mRNA synthesis is _____. A) A stop codon B) An enzyme whose specific function is to stop transcription C) A specific nucleotide sequence in DNA that signals the RNA polymerase to stop D) A specific nucleotide sequence in mRNA that signals the RNA polymerase to stop

D) Includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns

In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____. A) Includes the removal of introns before a cap and tail are added to the RNA molecule, forming the start site for translation once attached to the ribosome B) Includes the removal of exons before the addition of a cap and tail, which assist in binding of the ribosome C) Includes the addition of a cap and tail, which help in exporting the mRNA molecule from the nucleus, and the removal of exons D) Includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns

A) A set of triplet bases that is complementary to a codon triplet on mRNA

An anticodon is _____. A) A set of triplet bases that is complementary to a codon triplet on mRNA B) The amino acid attachment site in a tRNA molecule C) The DNA sequence that is complementary to a triplet codon in a mRNA molecule, for example, CTC D) An enzyme that specifically binds one type of amino acid to its appropriate tRNA molecule

D) The worker who puts all of the pieces together

If protein production were an assembly line, a ribosome would be _____. A) A loose piece that needs to be put together B) The foreman who barks out instructions C) The machines that move pieces to their appropriate locations D) The worker who puts all of the pieces together

B) Start codon on the mRNA molecule

At the start of translation, where does the initiator tRNA bind? A) P site B) Start codon on the mRNA molecule C) Promoter on the rRNA molecule D) A site

C) Transfer RNA

During the process of translation, __________ matches an mRNA codon with the proper amino acid. A) Messenger RNA B) A ribosome C) Transfer RNA D) DNA polymerase

D) Transfer RNA, ribosomes, AUG codons

The translation process requires all of the following: _____. A) Ribosomes, RNA polymerase, peptide bonding B) Peptide bonding, ribosomes, RNA polymerase C) RNA polymerase, AUG codons, transfer RNA D) Transfer RNA, ribosomes, AUG codons

B) Insertion

The type of mutation represented below is a(n) _____. The big red fly had one eye (wild type) The fbi gre dfl yha don eey (mutant) A) Single base substitution B) Insertion C) Deletion D) Addition of a codon

B) Whole viruses leave the host cell to infect other cells

During the lytic cycle, but not the lysogenic cycle, _____. A) A prophage is replicated during binary fission B) Whole viruses leave the host cell to infect other cells C) A phage injects DNA into the host cell D) A phage uses the host cell’s "machinery" to produce its proteins

C) A virus spreading from one host species to humans

Emerging viruses that infect human cells can originate from __________. A) Lambda viruses that were previously confined to bacterial populations that can now spread due to technological changes B) A rapidly mutating lytic phage C) A virus spreading from one host species to humans D) Lack of hygiene

D) Inhibition of reverse transcriptase

The drug AZT was one of the first drugs used to treat HIV. Which of the following drug actions would prevent the spread of HIV without harming the host cell? A) Prevention of the formation of glycoproteins B) Destruction of amino acids that are vital to viral protein synthesis C) Inhibition of DNA polymerase D) Inhibition of reverse transcriptase

D) Prions are proteins that are folded incorrectly.

Radiation is a frequent method of sterilization. It is effective because it causes damage to DNA. However, prions, the agents that cause diseases such as mad cow disease, are unaffected by these treatments because they lack DNA. What is the definition of a prion? Why? A) Prions are proteins folded into the correct configuration. B) Prions are small RNA molecules that do not encode proteins. C) Prions are small carbohydrate molecules that do not encode DNA. D) Prions are proteins that are folded incorrectly.

A) Conjugation, transformation, and transduction

Bacteria can quickly acquire new genes in a single generation through __________. A) Conjugation, transformation, and transduction B) Transformation only C) Rapid cell division D) Mutations

B) Two different species of bacteria can share DNA, including antibiotic-resistance genes, during conjugation.

Conjugation is a very effective process for spreading antibiotic resistance among diverse bacterial populations such as those found in the mammalian gut. Which statement best explains this observation? A) Conjugative plasmids cause a bacterial cell to reproduce more quickly, which increases the rate of evolution and the appearance of antibiotic resistance. B) Two different species of bacteria can share DNA, including antibiotic-resistance genes, during conjugation. C) Conjugative plasmids can be transferred to a bacteriophage. D) Conjugation is the only source of genetic variation in bacterial cells.

D) Nucleotides.

The monomers of DNA and RNA are A) Fatty acids. B) Nucleic acids. C) Monosaccharides. D) Nucleotides.

C) TGACA

What nucleotide sequence would be found on the partner DNA strand of the strand shown? A) UGAGA B) TGUGU C) TGACA D) ACTGT

C) The mutation results in mRNA being made from the protein.

A single base mutation occurs in a gene that codes for a protein due to an error in DNA replication. Which of the following outcomes would possibly not occur? A) The mutation results in improved, the same, or diminished protein function. B) The mutation results in a longer or shorter protein or a protein of the same length. C) The mutation results in mRNA being made from the protein. D) The mutation results in a human disease such as sickle-cell disease.

C) DNA template

Considering only the steps that take place during translation, which of the following is not needed in order for translation to occur? A) Sources of energy, including ATP B) tRNA C) DNA template D) Ribosomes

C) In the cytoplasm

Where do transcription and translation occur in prokaryotic cells? A) In the nucleus B) On the plasma membrane C) In the cytoplasm D) In chromatophores

B) The cycle typically leads to the lysis of the host cell.

Which of the following statements characterizes the lytic cycle of a viral infection? A) The cycle typically ends when the host bacterium divides. B) The cycle typically leads to the lysis of the host cell. C) The viral genes typically remain inactive once they are inside the host cell. D) The virus reproduces outside of the host cell.

B) Initiation of a new RNA molecule

Which of the following occurs when RNA polymerase attaches to the promoter DNA? A) Termination of the RNA molecule B) Initiation of a new RNA molecule C) Initiation of a new polypeptide chain D) Elongation of the growing RNA molecule

C) The conversion of genetic information from the language of nucleic acids to the language of proteins

Which of the following takes place during translation? A) DNA replication B) The conversion of genetic information from DNA nucleotides into RNA nucleotides C) The conversion of genetic information from the language of nucleic acids to the language of proteins D) The conversion of genetic information from the language of proteins to the language of enzymes

C) Shorten the time necessary for DNA replication.

Multiple origins of replication on the DNA molecules of eukaryotic cells serve to A) Create multiple copies of the DNA molecule at the same time. B) Assure the correct orientation of the two strands in the newly growing double helix. C) Shorten the time necessary for DNA replication. D) Remove errors in DNA replication.

C) Retrovirus

What kind of virus is HIV? A) Complex virus B) Provirus C) Retrovirus D) Paramyxovirus

D) Transcription.

The transfer of genetic information from DNA to RNA is called A) Initiation. B) Elongation. C) Translation. D) Transcription.

D) A mutation.

Any change in the nucleotide sequence of DNA is called A) A mutagen. B) A base substitution. C) An anticodon. D) A mutation.

C) CGAUCGCUACUG

What is the transcription product of the sequence GCTAGCGATGAC? A) CGUTCGCUTCUG B) CAGTAGCGATCG C) CGAUCGCUACUG D) CGTUCGCUTCUG

B) Hershey and Chase

Which of the following people conducted the experiments that demonstrated that DNA is the genetic material of bacteriophages? A) Watson and Crick B) Hershey and Chase C) Franklin D) Pauling

C) RNA uses the sugar dextrose.

Which of the following statements regarding RNA is false? A) One RNA molecule can include four different nucleotides in its structure. B) RNA uses the nitrogenous base uracil. C) RNA uses the sugar dextrose. D) RNA molecules have a sugar-phosphate backbone.

D) Exons are spliced together.

Which of the following statements about eukaryotic RNA is true? A) The modified RNA molecule is transported into the nucleus. B) A small cap of extra nucleotides is added to both ends of the RNA. C) Introns are added to the RNA. D) Exons are spliced together.

C) Uses each strand of a DNA molecule as a template for the creation of a new strand.

DNA replication A) Begins when two DNA molecules join together to exchange segments. B) Occurs through the addition of nucleotides to the end of the parental DNA molecule. C) Uses each strand of a DNA molecule as a template for the creation of a new strand. D) Results in the formation of four new DNA strands.

C) Leu – Ala – Arg – Tyr – Leu

Using the genetic code below, what protein sequence does the RNA sequence CUAGCUCGAUAUCUC code for? A) Asp – Ala – Arg – Ile- Leu B) Leu – Gly – Tyr – Ala Leu C) Leu – Ala – Arg – Tyr – Leu D) Val – Arg – Ala – Phe – Stop