|
Binary fission |
Mitosis in bacteria and other unicellular organisms |
|
Double helix |
Shape of a DNA molecule |
|
Pyrimidines |
Cytosine and thymine |
|
Metaphase |
Chromosomes line up along the equator of the cell |
|
Nucleotides |
Monomers of DNA |
|
Backbone |
Part of DNA made of sugar and phosphate groups |
|
Checkpoint |
Occurs at the end of G1 and G2 to make sure the cell can divide |
|
Chargaff |
His law is A=T and C=G; A+T does not equal C+G |
|
Mitosis |
Division of the nucleus |
|
46 |
Number of chromosomes in a normal human cell |
|
2 |
Number of hydrogen bonds between A and T |
|
3 |
Number of hydrogen bonds between G and C |
|
Nucleotide |
Made of sugar, phosphate group, and a nitrogen base |
|
Hydrogen |
Type of bond that holds the bases together in the ladder |
|
Sister chromatid |
The copy of an original chromatid |
|
Purines |
Guanine and adenine |
|
Wilkins and Franklin |
Studied the structure of DNA using x-ray chromatography |
|
Synthesis |
Part of interphase when DNA replicates |
|
Interphase |
Includes G1, S, and G2 |
|
Watson and Crick |
Scientists who won Nobel Prize for DNA structure |
|
Deoxyribonucleic acid |
Name of DNA |
|
Daughter |
Type of cells formed during mitosis |
|
Telophase |
Phase when the nuclear membrane reappears |
|
Vegetative propagation |
Mitosis in plant cells |
|
Anaphase |
Sister chromatids are pulled apart |
|
Cell plates |
Form in plant cells during telophase |
|
Centromere |
Holds sister chromatid together during mitosis |
|
Hershey and Chase |
Determined that DNA not proteins were the genetic material in cells |
|
Guanine |
Pairs with cytosine |
|
Cleavage furrows |
Form in animal cells during telophase |
|
Centriole |
Found in animal cells only; form spindle fibers |
|
Stem cells |
Undifferentiated body cells found in embryos and bone marrow |
|
Adenine |
Pairs with thymine |
|
Prophase |
Phase when the nuclear membrane disappears |
|
Cytokinesis |
Division of the cytoplasm at the end of mitosis |
|
C |
Which of the following represents the correct order of the phases of the cell cycle? A) G1 -> G2 -> S -> M B) G1 -> G2 -> M -> S C) G1 -> S -> G2 -> M D) G1 -> S -> M -> G2 E) G1 -> M -> G2 -> S |
|
D |
The division of the cytoplasm is called A) synapsis. B) mitosis. C) meiosis. D) cytokinesis. E) cytogenetics. |
|
B |
Which of the following represents the correct order of the phases of mitosis? A) prophase -> anaphase -> metaphase -> telophase B) prophase -> metaphase -> anaphase -> telophase C) prophase -> metaphase -> telophase -> anaphase D) metaphase -> prophase -> telophase -> anaphase E) metaphase -> prophase -> anaphase -> telophase |
|
B |
DNA replication occurs in mitosis. A) True B) False |
|
A |
Mitosis and cytoplasmic division result in the formation of two genetically identical cells. A) True B) False |
|
E |
The success of DNA replication is assessed during the ______ phase. A) G1 B) M C) C D) S E) G2 |
|
A |
The cell cycle is regulated by checkpoints during the _______ phases. A) G1, S and G2 B) G1, S and C C) G1, G2, and M D) G1, S and M E) G1, S, G2 and M |
|
A |
A eukaryotic cell that receives a "go-ahead" signal at the G1 checkpoint of the cell cycle will A) complete the cycle and divide. B) move directly into the M phase. C) move directly into the G2 phase. D) enter a resting stage. E) stop growing. |
|
A |
Preparation for cell division occurs in the G2 phase. A) True B) False |
|
A |
After cytokinesis, the cell enters the G1 phase. A) True B) False |
|
D |
Which of the following events do NOT occur in prophase of mitosis? A) DNA condenses to form chromosomes B) nuclear membrane breaks down C) nucleolus breaks down D) chromosomes are replicated E) mitotic spindle begins to form |
|
C |
The mitotic spindle fibers attach to chromosomes via special structures termed A) centrioles. B) asters. C) kinetochores. D) centrosomes. E) keratins. |
|
C |
Which of the following statements about microtubules during anaphase is TRUE? A) those attached to chromosomes elongate, while those that are unattached shorten B) those attached to chromosomes shorten, while those that are unattached elongate C) both attached and unattached microtubules shorten D) both attached and unattached microtubules elongate E) both attached and unattached microtubules elongate at first and then shorten |
|
B |
Centromeres divide during metaphase. A) True B) False |
|
B |
Cytokinesis in plant cells occurs by means of a cleavage furrow. A) True B) False |
|
A |
What part of the phage entered the bacterial cell following infection? A) DNA B) RNA C) Protein coat D) The entire phage E) No part |
|
D |
If ³⁵S was found in progeny phases rather than ³²P, Hershey and Chase would have concluded that: A) Proteins contain phosphorus B) DNA contains sulfur C) Phage DNA enters the host cell D) Phage protein enters the host cell E) Phage can kill the E. coli cell |
|
B |
In the Hershey and Chase experiment, radioactively-labeled: A) ³²P did not enter the cell B) ³²P remained inside the cells after vigorous shaking C) ³²P was removed from the cells by vigorous shaking D) ³²P and ³⁵S remained inside the cells after vigorous shaking E) ³²P and ³⁵S were removed from the cells after vigorous shaking |
|
True |
Hershey and Chase labeled the phage DNA with radioactive ³²P. True or false? |
|
True |
The phage used in the experiment consisted of a DNA molecule surrounded by a protein coat. True or false? |
|
Prophase |
During which stage of a cell’s cycle do the replicated chromosomes thicken and become visible? |
|
Centrioles, no |
In animal cell, which structure is thought to produce the spindle fibers that help separate the sister chromatids during anaphase? Is this structure found in plant cells |
|
Deoxyribonucleic acid |
What do the letters DNA stand for? |
|
Watson and Crick |
Two scientists were given credit for discovering the structure of DNA. What is the name of these two scientists? |
|
Nucleotide |
DNA is a polymer, which means that it is made up of many repeating single units (monomers). What are the monomers called? |
|
Sugar and phosphate group |
The backbone of the DNA molecule is made up of two components, what are these? |
|
Adenine, thymine, cytosine, guanine |
There are four different variations of these monomers (four different bases), what are the names of those bases? |
|
Two, one |
These bases are of two different types of molecules: purines and pyrimidines. Purines have _____ ring(s) in their structure, and pyrimidines have _____ ring(s) in their structure. |
|
Adenine and guanine |
The two bases that are purines are: |
|
Thymine and cytosine |
The two bases that are pyrimidines are: |
|
Adenine, thymine, guanine, cytosine |
Chargoff’s rule states that the DNA of any species contains equal amounts of ______ and ______ and also equal amounts of ______ and ______. |
|
Adenine, thymine, guanine, cytosine |
Based on this information, scientists could predict that the base ______ pairs with ______ and the base ______ pairs with ______ in the formation of the DNA molecule. |
|
Opposite |
This is called complementary base pairs. Thus one strand of DNA is complementary to the other strand (opposite/matching). |
|
Hydrogen |
The bases are paired by ______ bonds along the axis of the molecule. |
|
X-ray chromatography, double helix |
Wilkins and Franklin studied the structure of DNA using _____, a technique to examine molecules, and helped Watson and Crick determine the shape of a molecule was _____ _____. |
|
TTAAGCGGCCATAATCTGCAA |
Write the complementary sequence to the following DNA strand. AATTCGCCGGTATTAGACGTT |
|
Sugar |
Are the nitrogen bases attached to the sugar or the phosphate group? |
Share This
Flashcard
